Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10867

HP ID(1) HP10867
Gene ID(2)
Gene Symbol finder WDR89 (upstream, opposite)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 14q23.2
Reference DDBJ accession
UniGene Hs.680516

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe25G08 pKA1U5 AB371477 GACACCACCACGCCGTACGCTGCGTTAGCGGAAGTTTAATGGCCCCATTGGTGGGATGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl