Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10849

HP ID(1) HP10849
Gene ID(2) 5332
Gene Symbol finder PLCB4
Protein Name phospholipase C, beta 4
RefSeq NM_000933.2(5' ONLY)
Length of RefSeq (bp) 5536
Chromosome 20p12
Reference DDBJ accession
UniGene Hs.472101

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07G10 pKA1U5 GAGCAGCTCCAGGCAAAGTGACAGAGGACAGTGCTGCTGTGAGTTTGACGAAGTGGACAT
ARe55E09 pKA1U5 GACGCACACGCACACACGGGCGCGCACACACACGCNCGNTACACACTGGGTCTCCAGGCA
ARi50B01 pGCAP10 GGGGCTCGCGGCAACTGGGCGGCCGGCCCGGCCCCTGCCCACCCCCAGCCCAGCCCGGCG
ARiS161N14 pGCAP10 GGCCGGGAGCAGTAAGTGAGCTGCACCGCCAACAAGATCTCTCACACACAGACACACACA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl