Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10840

HP ID(1) HP10840
Gene ID(2) 84105
Gene Symbol finder PCBD2
Protein Name pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
RefSeq NM_032151.4
Length of RefSeq (bp) 2395
Chromosome 5q31.1
Reference DDBJ accession
UniGene Hs.710014

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa58G02 pKA1U5 GAGAGCCTAGGGCTAGCGGCCATGGGTGAGTGCACAGCGGCCGCGTGGGTGGGGGTCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl