Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10833

HP ID(1) HP10833
Gene ID(2)
Gene Symbol finder PPP1R14B(intron, opposite)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.697228

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe83F07 pKA1U5 AB371468 ATCCTGGACGCACGCCAAGATGGAGCTCCAGGCTAGCCCACAGAACAGCCCAGCCGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl