Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10832

HP ID(1) HP10832
Gene ID(2) 790955
Gene Symbol finder C11orf83
Protein Name chromosome 11 open reading frame 83
RefSeq NM_001085372.1
Length of RefSeq (bp) 658
Chromosome 11q12.3
Reference DDBJ accession
UniGene Hs.569009

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe17F12 pKA1U5 TGAGTGAGACCGCGCGGCAACAGCTTGCGGCTGCGGGGAGCTCCCGTGGGCGCTCCGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl