Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10804

HP ID(1) HP10804
Gene ID(2) 84309
Gene Symbol finder NUDT16L1
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
RefSeq NM_032349.2
Length of RefSeq (bp) 1341
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.592084

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07A03 pKA1U5 GGGGGACGGGGTCAGTGCCAAGATGTCGACGGCGGCGGTTCCGGAGCTGAAGCAGATCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl