Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10800

HP ID(1) HP10800
Gene ID(2) 54664
Gene Symbol finder TMEM106B
Protein Name transmembrane protein 106B
RefSeq NM_018374.3
Length of RefSeq (bp) 6514
Chromosome 7p21.3
Reference DDBJ accession
UniGene Hs.396358

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi57G02 pGCAP10 GGCTCCACCCCCCGGCTCCCGGGACTGTGGACTCCACGACCCTGTCCTCGGCCCTGTCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl