Prev. | NRCD Clone A | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10754

HP ID(1) HP10754
Gene ID(2) 55101
Gene Symbol finder ATP5SL
Protein Name ATP5S-like
RefSeq NM_018035.1
Length of RefSeq (bp) 1692
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.351099

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi70C04 pGCAP10 GACCTTAGCAAGATGGCGGCTCCCTGGGCGTCCCTGCGCCTGGTCGCCCCCATGTGGAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl