Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10741

HP ID(1) HP10741
Gene ID(2) 51526
Gene Symbol finder C20orf111
Protein Name chromosome 20 open reading frame 111
RefSeq NM_016470.6
Length of RefSeq (bp) 1572
Chromosome 20q13.11
Reference DDBJ accession
UniGene Hs.75798

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi26E05 pGCAP10 GAGTCGGGCGCCGAGATTTGGGAGAGACGCTCTGAACTGACTGCCCCGCATCACCGGAGC
ARi68D04 pGCAP10 GGAGGCGCGGGCCGCCCCCTTGGCTGGTTTGGATCCGGGTCAGTCGGGGGCCGAGATTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl