Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10724

HP ID(1) HP10724
Gene ID(2) 51337
Gene Symbol finder C8orf55
Protein Name chromosome 8 open reading frame 55
RefSeq NM_016647.2
Length of RefSeq (bp) 2264
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.368402

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb25D02 pGCAP1 GGAACCGGCACCGGCGCCACGGACTCCGCAGGACCCCGCGCCCGCCGCCGCCGCTATGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl