Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10712

HP ID(1) HP10712
Gene ID(2) 140738
Gene Symbol finder TMEM37
Protein Name transmembrane protein 37
RefSeq NM_183240.2
Length of RefSeq (bp) 1687
Chromosome 2q14.2
Reference DDBJ accession
UniGene Hs.26216

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi09B12 pGCAP10 GACAGCCGAGCAGCTGGAGCGATCGAGGCTGCAGCGCGGCCGCCGGGCGCAGCATGACTG
ARiS191L06 pGCAP10 GGCCCCGCCCGCCTCCAGCAGCCGCCCCGCCCCTGCGGAGAGGTCCCGGGCTGGCGCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl