Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10709

HP ID(1) HP10709
Gene ID(2) 80145
Gene Symbol finder THOC7
Protein Name THO complex 7 homolog (Drosophila)
RefSeq NM_025075.2
Length of RefSeq (bp) 1028
Chromosome 3p14.1
Reference DDBJ accession
UniGene Hs.288151

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi22H03 pGCAP10 GGCCGCCGCGCACGCCATGGGAGCCGTGACTGACGACGAAGTTATACGGAAGCGTCTCCT
ARi23E04 pGCAP10 GACGCCATGGGAGCCGTGACTGACGACGAAGTTATACGGAAGCGTCTCCTCATTGATGGA
ARi33G11 pGCAP10 GAGCTTGCGCCGCCGCCGCCGCCGCCGCCGCCGCGCACGCCATGGGAGCCGTGACTGACG
ARi49F06 pGCAP10 GGCCGCCGCGCACGCCATGGGAGCCGTGACTGACGACGAAGTTATACGGAAGCGTCTCCT
ARiS096P13 pGCAP10 GGCGCCGCCGCCGCCGCCGCCGCCGCCGCGCACGCCATGGGAGCCGTGACTGACGACGAA
RBb36B05 pGCAP1 TGGACGCCATGGGAGCCGTGACTGACGACGAAGTTATACGGAAGCGTCTCCTCATTGATG
RBd09C01 pGCAP10 GGCCGCCGCCGCCGCCGCGCACGCCATGGGAGCCGTGACTGACGATATAGCCAGTACCAA
RBd30D03 pGCAP10 GGCGCCGCCGCCGCCGCCGCCGCCGCCGCGCACGCCATGGGAGCCGTGACTGACGACGAA
RBd99B04 pGCAP10 GGCCGCCGCCGCCGCCGCGCACGCCATGGGAGCCGTGACTGACGATATAGCCAGTACCAA
RBdS177B14 pGCAP10 GGCGGCGCGGCGCNNCTCAGGCGTCGGAGCAGNNNNNTNNNTNCGCAANAGCAACCNCNN

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl