Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10697

HP ID(1) HP10697
Gene ID(2) 64115
Gene Symbol finder C10orf54
Protein Name chromosome 10 open reading frame 54
RefSeq NM_022153.1
Length of RefSeq (bp) 4774
Chromosome 10q22.1
Reference DDBJ accession
UniGene Hs.47382

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS008D16 pGCAP10 GACTCAGTCGCGGGAGGCTTCCCCGCGCCGGCCGCGTCCCGCCCGCTCCCCGGCACCAGA
ARiS198I11 pGCAP10 GACTCAGTCGCGGGAGGCTTCCCCGCGCCGGCCGCGTCCCGCCCGCTCCCCGGCACCAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl