Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10688

HP ID(1) HP10688
Gene ID(2) 80761
Gene Symbol finder UPK3B
Protein Name uroplakin 3B
RefSeq NM_030570.2
Length of RefSeq (bp) 1625
Chromosome 7q11.2
Reference DDBJ accession
UniGene Hs.488861

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi61D02 pGCAP10 GGGGGGTGAGGTGCAGCCCGAAGCAGCCAGACCAGCCCCTGAGCCTCCCGGGTGCTGGCA
RBdS081G11 pGCAP10 GAGACCAGCCCCTGANCCTCCCGGGTGCTGGCAGCTGTCATGGGGCTACCCTGGGGGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl