Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10650

HP ID(1) HP10650
Gene ID(2) 54069
Gene Symbol finder C21orf45
Protein Name chromosome 21 open reading frame 45
RefSeq NM_018944.2
Length of RefSeq (bp) 1587
Chromosome 21q22.11
Reference DDBJ accession
UniGene Hs.190518

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb27F07 pGCAP1 TGGGGGCGCGGGCGATTTGTAGGTAATGGCAGGCGTTCGGTCACTGAGGTGTAGCAGAGG
RBd71H10 pGCAP10 GGATTTGTAGGTAATGGCAGGCGTTCGGTCACTGAGGTGTAGCAGAGGATGCGCTGGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl