Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10629

HP ID(1) HP10629
Gene ID(2) 84899
Gene Symbol finder TMTC4
Protein Name transmembrane and tetratricopeptide repeat containing 4
RefSeq NM_032813.2
Length of RefSeq (bp) 3771
Chromosome 13q32.3
Reference DDBJ accession
UniGene Hs.713610

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd62D10 pGCAP10 GAGAGTTTCCGCACCCGGGAGGGAGATGCGGCCGGGGCTCAGGCTCCTTGCAGTTGTAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl