Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10557

HP ID(1) HP10557
Gene ID(2) 29937
Gene Symbol finder NENF
Protein Name neuron derived neurotrophic factor
RefSeq NM_013349.3
Length of RefSeq (bp) 944
Chromosome 1q32.3
Reference DDBJ accession
UniGene Hs.461787

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13D09 pKA1U5 GGCGCTCACCATGGNTGGGCCCCGCGCCGCGGCGGCGGCTGCGGCCGCTGGCAGCGCTGG
ARe76C07 pKA1U5 GGCCCTGGCCCGGCCTTGCCTTGCGCTGCGCCCCTTTNAATGGAGGGGCCCGCGACCGCG
ARe95H12 pKA1U5 GGCCCTGGCCCGGCCTTGCCTTGCGCTGCGCGCTCACCATGGTGGGCCCCGCGCCGCGGC
ARi21E07 pGCAP10 GANTGGGCCCGGCCTTGCCTTGCGCTGCGCGCTCACCATGGTGGCCCCCGCGCCGCGGCG
ARi21F02 pGCAP10 CGGCCGGCCGATGCCCCAGTGCGGCTTTTCACCGAGGAGGAGCTGGCCCGCTATGGCGGG
ARi50B12 pGCAP10 GAGGGCCCCGCCGCCCTGGCCCGGCCTTGCCTTGCGCTGCGCGCTCACCATGGTGGGCCC
ARiS088L05 pGCAP10 GGGCCCGGCCTTGCCTTGCGCTGCGCGCTCACCATGGTGGGCCCCGCGCCGCGGCGGCGG
RBd01E11 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl