Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10527

HP ID(1) HP10527
Gene ID(2) 84522
Gene Symbol finder JAGN1
Protein Name jagunal homolog 1 (Drosophila)
RefSeq NM_032492.2
Length of RefSeq (bp) 1656
Chromosome 3p25.2
Reference DDBJ accession
UniGene Hs.24054

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe38A11 pKA1U5 GCTCTTCACGGAGCCGCGCGGCTGCGGGGGCGCAAATAGGGTCAGTGGGCCGCTTGGCGG
ARe44B10 pKA1U5 GCTTCACGGAGCCGCGCGGCTGCGGGGGCGCAAATAGGGTCACTGGGCCGCTTGGCGGTG
RBb12E05 pKA1U5 TGGACGGAGCCGCGCGGCTGCGGGGGCGCAAATAGGGTCAGTGGGCCGCTTGGCGGTGTC
RBd09A02 pGCAP10 GACGGAGCCGCGCGGCTGCGGGGGCGCAAATAGGGTCACTGGGCCGCTTGGCGGTGTCGT
RBd11D02 pGCAP10 GGCGCGGCTGCGGGGGCGCAAATAGGGTCACTGGGCCGCTTGGCGGTGTCGTTGCGGTAC
RBd34D06 pGCAP10 GGGGGGCGCAAATAGGGTCAGTGGGCCGCTTGGCGGTGTCGTTGCGGTACCAGGTCCGCG
RBd84B09 pGCAP10 GGGTCCTCCAGAGACAGAGGGGCCGGAAGTTCTCTTCACGGAGCCGCGCGGCTGCGGGGG
RBdS081P02 pGCAP10 GACGGAGCCGCGCGGCTGCGGGGGCGCAAATAGGGTCAGTGGGCCGCTTGGCGGTGTCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl