Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10502

HP ID(1) HP10502
Gene ID(2) 79101
Gene Symbol finder TAF1D
Protein Name TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
RefSeq NM_024116.2
Length of RefSeq (bp) 1282
Chromosome 11q21
Reference DDBJ accession
UniGene Hs.355750

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi60F02 pGCAP10 GCCTTTTCTTCCGCACGGTTGGAGGAGGTCGGCTGGTTATCGGGAGTTGGAGGGCTGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl