Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10496

HP ID(1) HP10496
Gene ID(2) 8409
Gene Symbol finder UXT
Protein Name ubiquitously-expressed transcript
RefSeq NM_004182.2
Length of RefSeq (bp) 575
Chromosome Xp11.23-p11.22
Reference DDBJ accession
UniGene Hs.172791

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe45A03 pKA1U5 GAGCCGCGGTTCCTACCAACCGTTCTTATTGCTGGCGGCCTGAGGAGCCCATCATGGCGA
ARe58C02 pKA1U5 GGTTCTTATTGCTGGCGGCCTGAGGAGCCCATCATGGCGACGCCCCCTAAGCGGCGGGCG
ARe67H10 pKA1U5 GACCGTTCTTATTGCTGGCGGCCTGAGGAGCCCATCATGGCGACGCCCCCTAAGCGGCGG
ARiS088H11 pGCAP10 GGGAAGCCGCGGTTCCTACCAACCGTTCTTATTGCTGGCGGCCTGAGGAGCCCATCATGG
RBb31B06 pGCAP1 GGCGGTTCCTACCAACCGNTTCTTATTGCTGGCGGCCTGAGGAGCCCATCATGGCGACGC
RBb61H01 pGCAP1

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl