Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10480

HP ID(1) HP10480
Gene ID(2) 64065
Gene Symbol finder PERP
Protein Name PERP, TP53 apoptosis effector
RefSeq NM_022121.2
Length of RefSeq (bp) 1941
Chromosome 6q24
Reference DDBJ accession
UniGene Hs.520421

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe72H05 pKA1U5 GACTCTCTGCTGTCGCCCGTCCCGCGCGCTCCTCCGATCCGCTCCGCTCCGCTCCGCTCG
ARe99F04 pKA1U5 GCTCTTCGCTTTTGTGGCGGCGCCCGCGCTCGCAGGCCACTCTCTGCTGTCGCCCGTCCC
ARf02G05 pKA1U5 TGGGGGAGCCGCCTCCCCGCGGCCTCTTCGCTTTTGTGGCGGCGCCCGCGCTCGCAGGCC
ARiS194J07 pGCAP10 TCTTCNCTTTTGTGGCGGCGCCCGCGCTCGCAGGCCACTCTCTGCTGTCGCCCGTCCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl