Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10473

HP ID(1) HP10473
Gene ID(2) 10419
Gene Symbol finder PRMT5
Protein Name protein arginine methyltransferase 5
RefSeq NM_006109.3
Length of RefSeq (bp) 2385
Chromosome 14q11.2-q21
Reference DDBJ accession
UniGene Hs.367854

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022L06 pGCAP10 GAGTATCAAGGAATCCCGGCGTGGACAGCGCGAGGAGAAAGATGGCGGCGATGGCGGTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl