Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10422

HP ID(1) HP10422
Gene ID(2) 125144
Gene Symbol finder C17orf45
Protein Name chromosome 17 open reading frame 45
RefSeq NR_027158.1
Length of RefSeq (bp) 892
Chromosome 17p11.2
Reference DDBJ accession
UniGene Hs.368934

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01D01 pKA1U5 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCACAGCCTGGAGTCTGCGAAGGC
ARe24B06 pKA1U5 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
ARe43G04 pKA1U5 GCTTTTCATTCCCGNTTGTTATGGAGGGCCACATCCTGTTNAGAGCCTGGAGTCTGCGAA
ARe90F04 pKA1U5 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
ARe97F09 pKA1U5 GCCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGG
ARi17A12 pGCAP10 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
ARi26D03 pGCAP10 GCTTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGG
ARi26E02 pGCAP10 GCTTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGG
ARi38D01 pGCAP10 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
ARi67H05 pGCAP10 TGCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGG
ARiS088F21 pGCAP10 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
RBb01B09 pKA1U5 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
RBb58E02 pGCAP1 GCTTTTCATTCCCGCTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGG
RBd05E11 pGCAP10 TTTTTTTTTTTTGAGACAGTCTTGCTGTATTGCCCAGGCTGGAGTGTGGTGGCACAATCA
RBd11G10 pGCAP10 GCTTTTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAA
RBd51F11 pGCAP10 GCTTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGG
RBd57A06 pGCAP10 TGCTTTTTTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCNGAGCCTGGAGTCTGC
RBd70D07 pGCAP10 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
RBd82H10 pGCAP10 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
RBd92H08 pGCAP10 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
RBd94D09 pGCAP10 TGCTTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAG
RBd95C05 pGCAP10 GCTTTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAG
RBdS013N15 pGCAP10 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC
RBdS022G05 pGCAP10 GACCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAG
RBdS070F19 pGCAP10 GCTTTTCATTCCCGTTGTTATGGAGGTAGGCTCTCTAGGAATCTGGGAGTAGTAGCTGGG
RBdS154N06 pGCAP10 GCTTTTCATTCCCGTTGTTATGGAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl