Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10413

HP ID(1) HP10413
Gene ID(2) 10857
Gene Symbol finder PGRMC1
Protein Name progesterone receptor membrane component 1
RefSeq NM_006667.3
Length of RefSeq (bp) 1928
Chromosome Xq22-q24
Reference DDBJ accession
UniGene Hs.90061

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01H10 pKA1U5 GACTCGCTCGCTCAGAGGGAGGAGAAAGTGGCCCANTTCCGGATCCCTGCCTAGCGCGGC
ARe77A02 pKA1U5 GAACCTTTACTCCAGAGATCATGGCTGCCGAGGCNTGTGGATGGCGACTGGCGCCGACCC
ARiS191O18 pGCAP10 GAGAGGGAGGAGAAAGTGGCGAGTTCCGGATCCCTGCCTAGCGCGGCCCAACCTTTACTC
RBb54H02 pGCAP1 AAATGTGGACTCCAGAGATCATGGCTGCCGAGGATGTGGTGGCGACTGGCGCCGACCCAA
RBb56E05 pGCAP1 GACTCGCTCGCTCAGAGGGAGGAGAAAGTGGCGAGTTCCGGATNCCTGCCTAGCGCGGCC
RBd39H10 pGCAP10 TTTGAAAGTGGCGAGTTCCGGATCCCTGCCTAGCGCGGCCCAACCTTTACTCCAGAGATC
RBd55D10 pGCAP10 GGTCTTTGGCCGCCGCCGAACCCCGCGCGCCACTCGCTCNNNNNNNNNNNNGAGAAAGTG
RBd55E09 pGCAP10 GGTCTTTGGCCGCCGCCGAACCCCGCGCGCCACTCGCTCGCTCNGANGGAGGAGAAAGTG
RBd69F03 pGCAP10 GAGTCTTTGGCCCCCGCCAAACCCCGCGCGCCACTCCCTCCCTCTCAGAGAGGAGAAACT
RBd71C01 pGCAP10 GACTCGCTCGCTCAGAGGGAGGAGAAAGTGGCGAGTTCCGGATCCCTGCCTAGCGCGGCC
RBd93H03 pGCAP10 GTTCACCCCCGCCGAGCTGCGGCGCTTCGACGGCGTCCAGGACCCGCGCATACTCATGGC
RBdS014A11 pGCAP10 GAGAGGGAGGAGAAAGTGGCGAGTTCCGGATCCCTGCCTAGCGCGGCCCAACCTTTACTC
RBdS040K11 pGCAP10 GACCTTTACTCCAGAGATCATGGCTGCCGAGGATGTGGTGGCGACTGGCGCCGACCCAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl