Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10392

HP ID(1) HP10392
Gene ID(2) 51075
Gene Symbol finder TXNDC14
Protein Name thioredoxin domain containing 14
RefSeq NM_015959.1
Length of RefSeq (bp) 1669
Chromosome 11cen-q22.3
Reference DDBJ accession
UniGene Hs.654965

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26B09 pKA1U5 GAGTGGCCGTTACGGCCGAAAAGATGGCGGTCTTGGCACCTCTAATTGCTCTCGTGTATT
ARe45C10 pKA1U5 ATCCTGATGGGAAAAAAGATGGCGGTCTTGGCACCTCTAATTGCTCTCGTGTATTCGGTG
ARe98C12 pKA1U5 GAGCAGTGGCCGTTACGGCCGAAAAGATGGCGGTCTTGGCACCTCTAATTGCTCTCGTGT
ARiS020K14 pGCAP10 CGGCCGGCCGATGGTTACGGCCGAAAAGATGGCGGTCTTGGCACCTCTAATTGCTCTCGT
RBd46D02 pGCAP10 GAGTGGCCGTTACGGCCGAAAAGATGGCGGTCTTGGCACCTCTAATTGCTCTCGTGTATT
RBd71C02 pGCAP10 TTGACGGCCGAAAAGATGGCGGTCTTGGCACCTCTAATTGCTCTCGTGTATTCGGTGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl