Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10356

HP ID(1) HP10356
Gene ID(2) 56647
Gene Symbol finder BCCIP
Protein Name BRCA2 and CDKN1A interacting protein
RefSeq NM_016567.3
Length of RefSeq (bp) 1461
Chromosome 10q26.1
Reference DDBJ accession
UniGene Hs.715543

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi62B06 pGCAP10 GGAGCGGCAACATGGCGTCCAGGTCTAAGCGGCGTGCCGTGGAAAGTGGGGTTCCGCAGC
RBb21D05 pKA1U5 GGTGAGCGGCAACATGGCGTCCAGGTCTAAGCGGCGTGCCGTGGAAAGTGGGGTTCCGCA
RBb51H09 pGCAP1 GGAGCGGCAACATGGCGTTCCAGGTCTAAGCGGCGTGCCGTGGAAAGTGGGGTTCCGCAG
RBd39D09 pGCAP10 GGAGCGGCAACATGGCGTCCAGGTCTAAGCGGCGTGCCGTGGAAAGTGGGGTTCCGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl