Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10349

HP ID(1) HP10349
Gene ID(2) 9528
Gene Symbol finder TMEM59
Protein Name transmembrane protein 59
RefSeq NM_004872.3
Length of RefSeq (bp) 1709
Chromosome 1p36-p31
Reference DDBJ accession
UniGene Hs.523262

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe90B06 pKA1U5 GAGAGGGGAACAAGATGGCGGCGCCGAAGGGGAGCCTCTGGGTGAGGACCCAACTGGGGC
ARi07C09 pGCAP10 GAGCAACAAGCTGAGCTGCTGTGACAGAGGGGAACAAGATGGCGGCGCCGAAGGGGAGCC
RBd08A10 pGCAP10 GAGAGGGGAACAAGATGGCGGCGCCGAAGGGGAGCCTCTGGGTGAGGACCCAACTGGGGC
RBd46B04 pGCAP10 TGGACAGAGGGGAACAAGATGGCGGCGCCGAAGGGGAGCCTCTGGGTGAGGACCCAACTG
RBdS132O10 pGCAP10 GCCTTCCGAGAAAACAGCAACAAGCTGAGCTGCTGTGACAGAGGGGAACAAGATGGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl