Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10173

HP ID(1) HP10173
Gene ID(2) 51504
Gene Symbol finder TRMT112
Protein Name tRNA methyltransferase 11-2 homolog (S. cerevisiae)
RefSeq NM_016404.1
Length of RefSeq (bp) 612
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.333579

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe43E07 pKA1U5 AGCAGCGGAGGACGACCTTTTTCCGGTTCCGGCCTGGCGAGAGTTTGTGCGGCGACATGA
ARe52C02 pKA1U5 TTTTTGTGCGGCGACATGAAACTGCTTACCCACANCTCTTGCTGAGCTCGCATGTGCGGG
ARe63E03 pKA1U5 GGTGCGGCGACATGAAACTGCTTACCCACAATCTGCTGAGCTCGCATGTGCGGGGGGTGG
ARe66E02 pKA1U5 GCCGGTTCCGGCCTGGCGAGAGTTTGTGCGGCGACATGAAACTGCTTACCCACAATCTGC
ARe68H04 pKA1U5 ATCCTGTATAGAGTTTGTGCGGCGACATGAAACTGCTTACCCACAATCTGCTGAGCTCGC
ARi02F03 pGCAP10 GGGCGAGAGTTTGTGCGGCGACATGAAACTGCTTACCCACAATCTGCTGAGCTCGCATGT
ARi71E05 pGCAP10 GGTGCGGCGACATGAAACTGCTTACCCACAATCTGCTGAGCTCGCATGTGCGGGGGGTGG
ARiS008P23 pGCAP10 GGTGCGGCGACATGAAACTGCTTACCCACAATCTGCTGAGCTCGCATGTGCGGGGGGTGG
ARiS049O02 pGCAP10 GCCGGCCTGGCGAGAGTTTGTGCGGCGACATGAAACTGCTTACCCACAATCTGCTGAGCT
ARiS150E19 pGCAP10 GAGTTTGTGCGGCNACATNANNCTGCTTACCCACAATCTGCTGAGCTCGCATGTGCGGGG
RBb14B06 pKA1U5 GCCGGTTCCGGCCTGGCGAGAGTTTGTGCGGCGACATGAAACTGCTTACCCACAATCTGC
RBd32B10 pGCAP10 GGGGGTCCCGTGGCTTCCCCCTGCGCCTCCAGGCCACCGAGGTCCGTATCTGCCCTGTGG
RBd48F02 pGCAP10 GAGAGTTTGTGCGGCGACATGAAACTGCTTACCCACAATCTGCTGAGCTCGCATGTGCGG
RBd71B05 pGCAP10 GAGAGTTTGTGCGGCGACATGAAACTGCTTACCCACAATCTGCTGAGCTCGCATGTGCGG
RBd77B03 pGCAP10 GGGCAGCGGAGGACGACCTTTTTCCGGTTCCGGCCTGGCGAGAGTTTGTGCGGCGACATG
RBdS022L24 pGCAP10 GAGTTTGTGCGGCGACATGAAACTGCTTACCCACAATCTGCTGAGCTCGCATGTGCGGGG
RBdS154E01 pGCAP10 GGGTGCGNCNACATGAAACTGCTTACCCNCNNNNTGCTGAGCTCGCATGTGCGGGGGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl