Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10137

HP ID(1) HP10137
Gene ID(2) 25934
Gene Symbol finder NIPSNAP3A
Protein Name nipsnap homolog 3A (C. elegans)
RefSeq NM_015469.1
Length of RefSeq (bp) 1664
Chromosome 9q31.1
Reference DDBJ accession
UniGene Hs.530275

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS055H12 pGCAP10 GAGCCTGCGTCTGCCAATGATCCAGGAGCCGCTCCTTTCCACTCGGGAAACCTTCAGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl