Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10106

HP ID(1) HP10106
Gene ID(2) 79023
Gene Symbol finder NUP37
Protein Name nucleoporin 37kDa
RefSeq NM_024057.2
Length of RefSeq (bp) 1228
Chromosome 12q23.2
Reference DDBJ accession
UniGene Hs.444276

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi45C03 pGCAP10 ACAGCGCGTCGCGGCAGCCCCCAAGGAAGACCAGCCTGCCTCTGGTCGGTTCCTGGCGCT
ARiS087K02 pGCAP10 GGGCAGCCCCCAAGGAAGACCAGCCTGCCTCTGGTCGGTTCCTGGCGCTCTGCGTTTCGT
RBd93H08 pGCAP10 GCTCTGGTCGGTTCCTGGCGCTCTGCGTTTCGTGACCTTGTCCAGTAGAAGGCTATTTAA
RBdS156F16 pGCAP10 GCTGCCTCTGGTCGGTTCCTGGCGCTCTGCGTTTCGTGACCTTGTCCAGTAGAAGGCTAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl