Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10076

HP ID(1) HP10076
Gene ID(2) 51651
Gene Symbol finder PTRH2
Protein Name peptidyl-tRNA hydrolase 2
RefSeq NM_016077.3
Length of RefSeq (bp) 804
Chromosome 17q23.1
Reference DDBJ accession
UniGene Hs.12677

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi05B08 pGCAP10 GAGAAACGTGTTCGCTGCCCAGAAGAAGGGAAGGCGCGAGTGAGGAAAGGAGGTACTGTA
RBd20C05 pGCAP10 GACGCGATAGAAACGTGTTCGCTGCCCAGAAGAAGGGAAGGCGCGAGTGAGGAAAGGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl