Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10022

HP ID(1) HP10022
Gene ID(2) 6881
Gene Symbol finder TAF10
Protein Name TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa
RefSeq NM_006284.2
Length of RefSeq (bp) 762
Chromosome 11p15.3
Reference DDBJ accession
UniGene Hs.5158

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe29E12 pKA1U5 GGCTGCAGCGGCTCCGGCGCGGACCCCGAGGCGGCGCCGGCCTCCGCCGCCTCGGCCCCG
ARe37B06 pKA1U5 GGGCCCGATGAGCTGCAGCGGCTCCNGCGCGGACCCCGAGGCGGCGCCGGCCTCCGCCGC
ARi25H10 pGCAP10 GCTGTTCGCCGCCTCTCCCACCGGCCCGATGAGCTGCAGCGNCCNNGGCGCGGACCCCGA
RBb05H09 pKA1U5 TGCCCACCGGCCCGATGAGCTGCAGCGGCTCCCCNNTTANACCCCGAGGCGGCGCCGGCC
RBd20G03 pGCAP10 TGCCCGATGAGCTGCAGCGGCTCCGGCGCGGACCCCGAGGCGGCGCCGGCCTCCGCCGCC
RBd90B05 pGCAP10 GGCCTCTCCCACCGGCCCGATGAGCTGCAGCGGCTCCGGCACGGACCCCAAGGCGGCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl