Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09298

HP ID(1) HP09298
Gene ID(2)
Gene Symbol finder TARBP2(exon1, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 12q13.13
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd52G12 pGCAP10 AB593181 GATGCTGGGGCCGCGCCGCTACTCCCTCCGCACGGCCCCACGCTTTTCGCCCTGAAGGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl