Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09280

HP ID(1) HP09280
Gene ID(2)
Gene Symbol finder PCDHAC1(upstream, opposite)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 5q31.3
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS187C01 pGCAP10 GAGCAGCGGGCTGGGGTCTCGACCACAACGCTGGCTGCGGGCGCAGGGCGGAGCCTGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl