Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09226

HP ID(1) HP09226
Gene ID(2) 65977
Gene Symbol finder PLEKHA3
Protein Name pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3
RefSeq NM_019091.3
Length of RefSeq (bp) 2516
Chromosome 2q31.2
Reference DDBJ accession
UniGene Hs.41086

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS154L15 pGCAP10 GGGGTGTGACGCGCCGGCCCGCCCTCCTCGCGCAGCCTCCGGCTAGGCGGCGAGGCCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl