Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09198

HP ID(1) HP09198
Gene ID(2) 7084
Gene Symbol finder TK2
Protein Name thymidine kinase 2, mitochondrial
RefSeq NM_004614.3
Length of RefSeq (bp) 3675
Chromosome 16q22-q23.1
Reference DDBJ accession
UniGene Hs.512619

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS132N09 pGCAP10 GGAAGCGCCTCTTCCGAGGCGCGGGATTTCCTCCCCGGCTGCGGCTGGGACGGGGGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl