Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09197

HP ID(1) HP09197
Gene ID(2)
Gene Symbol finder PRKACB(upstream, opposite)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 1p31.1
Reference DDBJ accession
UniGene Hs.145520

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS132M11 pGCAP10 GGCGGTGGACCCCCAGCTGGCAGAGCCTGGGGCGGGGGCCTGAGGTGGCGTGGACCGCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl