Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09187

HP ID(1) HP09187
Gene ID(2) 56983
Gene Symbol finder KTELC1
Protein Name KTEL (Lys-Tyr-Glu-Leu) containing 1
RefSeq NM_152305.2
Length of RefSeq (bp) 3552
Chromosome 3q13.33
Reference DDBJ accession
UniGene Hs.231750

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS132I15 pGCAP10 GAGTAGGTCTGCCGGCGATGGAGTGGTGGGCTAGCTCGCCGCTTCGGCTCTGGCTGCTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl