Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09176

HP ID(1) HP09176
Gene ID(2) 81930
Gene Symbol finder KIF18A
Protein Name kinesin family member 18A
RefSeq NM_031217.3
Length of RefSeq (bp) 3463
Chromosome 11p14.1
Reference DDBJ accession
UniGene Hs.301052

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS110P16 pGCAP10 GGAAGCGCTGGGAGGCGGACATTAAAGTGAAGTGGTTGCGGTAACCTGGCCTGGGCCTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl