Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09151

HP ID(1) HP09151
Gene ID(2) 60673
Gene Symbol finder C12orf44
Protein Name chromosome 12 open reading frame 44
RefSeq NM_001098673.1
Length of RefSeq (bp) 1287
Chromosome 12q13.13
Reference DDBJ accession
UniGene Hs.9911

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS105P15 pGCAP10 GGGGAGAGTGGTGGCATCTGAGAGGCTGGTCGTGGACTGTGGTTGGGGGAGGTGGGAGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl