Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09150

HP ID(1) HP09150
Gene ID(2)
Gene Symbol finder BAZ1A(exon 2, antisense)
Protein Name Homo sapiens cDNA clone IMAGE:4823416
RefSeq
Length of RefSeq (bp) 2134
Chromosome 14q13.2
Reference DDBJ accession BC039097.1
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS105P04 pGCAP10 GGCGGCCAAGAGGGCGGGAGGGCGACAGCAGCGGCTAGGAGCGGTCCCCGAGGCCGGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl