Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09126

HP ID(1) HP09126
Gene ID(2)
Gene Symbol finder PELP1(exon 1, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 17p13.2
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS105B22 pGCAP10 GGGTTCCCGGAGTGATGGCGGATGAGGCTGCCTGTGAGCGTGTCCGAGGCGGTCCTGTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl