Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09118

HP ID(1) HP09118
Gene ID(2) 200728
Gene Symbol finder TMEM17
Protein Name transmembrane protein 17
RefSeq NM_198276.2
Length of RefSeq (bp) 1925
Chromosome 2p15
Reference DDBJ accession
UniGene Hs.308028

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS104M02 pGCAP10 GGCAGACTAGCCCGTGTCTGAGGGGGTGAGGGATACTGAGGCCCAGGCATGGAGCTGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl