Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09104

HP ID(1) HP09104
Gene ID(2)
Gene Symbol finder TSC22D1(intron)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 13q14.11
Reference DDBJ accession
UniGene Hs.657406

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS104D08 pGCAP10 GGTTTACAAACACATATAAATTAAAAAAAACAACTGTCCATCGTTTTAGGAAGAACTGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl