Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09091

HP ID(1) HP09091
Gene ID(2) 400818
Gene Symbol finder NBPF9
Protein Name neuroblastoma breakpoint family, member 9
RefSeq NM_001037675.2
Length of RefSeq (bp) 2931
Chromosome 1q21.1
Reference DDBJ accession
UniGene Hs.534675

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083J18 pGCAP10 GGCGCCTTGGGCTCTCCTGACGCGCCGAGCGGGACCCTGAGGATCCAGCTGGCCGCAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl