Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09085

HP ID(1) HP09085
Gene ID(2) 23397
Gene Symbol finder NCAPH
Protein Name non-SMC condensin I complex, subunit H
RefSeq NM_015341.3
Length of RefSeq (bp) 4495
Chromosome 2q11.2
Reference DDBJ accession
UniGene Hs.308045

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083G06 pGCAP10 GAAAACCAGCTCAGGAGACGCCAAGGAAAGATGGGACCTCCCGGCCCAGCACTGCCAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl