Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09080

HP ID(1) HP09080
Gene ID(2) 63899
Gene Symbol finder NSUN3
Protein Name NOL1/NOP2/Sun domain family, member 3
RefSeq NM_022072.3
Length of RefSeq (bp) 1465
Chromosome 3q11.2
Reference DDBJ accession
UniGene Hs.448003

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083E21 pGCAP10 CGGCCGGCCGATGAGTATCTCGCGAGAAATTGAAGAGGAAACGTGAGAATGAAAGTGGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl