Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09075

HP ID(1) HP09075
Gene ID(2) 55015
Gene Symbol finder PRPF39
Protein Name PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)
RefSeq NM_017922.3
Length of RefSeq (bp) 2894
Chromosome 14q21.3
Reference DDBJ accession
UniGene Hs.274337

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083C21 pGCAP10 GCTGGACCAGGCGGCCGTGGCGCGGGTGGCGGCTGCTGTGCTGGCTGTGGGGACGGAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl