Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09074

HP ID(1) HP09074
Gene ID(2) 4796
Gene Symbol finder NFKBIL2
Protein Name nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2
RefSeq NM_013432.4
Length of RefSeq (bp) 4519
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.675285

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083C20 pGCAP10 GGCGGGAAGTCCGGATCCCGCGGCGATCCGAGCATGAGCCTGGAGCGCGAGCTTCGCCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl