Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09069

HP ID(1) HP09069
Gene ID(2)
Gene Symbol finder TAPBP(downstream, opposite)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 6p21.32
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS081M14 pGCAP10 GAGAGGCTTCCGGCGCCGAGACCGAGATCCCCGTCGGCTCGGTGTATCCTCGCTGGTGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl